browser icon
Você está usando uma versão insegura do seu navegador web. Por favor atualize seu navegado!
Usando um navegador desatualizado torna seu computador inseguro. Para mais segurança, velocidade, uma experiência mais agradável, atualize o seu navegador hoje ou tente um novo navegador.

O Código Cósmico – 7 – Sabedoria Secreta, Textos Sagrados

Posted by on 31/01/2020

A ciência – a compreensão do funcionamento dos céus e da Terra – era posse dos “deuses” (Elohim); assim as pessoas acreditavam, sem sombra de dúvida. Era um segredo dos “deuses” (Elohim) a ser escondido da Humanidade, ou revelado, de tempos em tempos e apenas parcialmente a indivíduos selecionados – iniciados nos segredos divinos. “Tudo o que sabemos nos foi ensinado pelos deuses”, afirmavam os sumérios em seus escritos; nisso estão os fundamentos, ao longo dos milênios e em nossos próprios tempos, da Ciência e Religião, do revelado e do oculto. Em primeiro lugar havia a Sabedoria Secreta; o que foi revelado quando a Humanidade recebeu o Entendimento tornou-se Sabedoria Sagrada, o alicerce das civilizações e dos avanços humanos. Quanto aos segredos que os “deuses” (Elohim) guardaram, no final provaram ser os mais devastadores para a espécie humana.

Edição e imagens: Thoth3126@protonmail.ch

Livro O CÓDIGO CÓSMICO – A fantástica História dos Extraterrestres que Revelaram os Segredos Cósmicos à Humanidade (Zecharia Sitchin)

CAPÍTULO 7 – Sabedoria Secreta, Textos Sagrados

É preciso também considerar a busca infindável pelo que está oculto, algumas vezes sob a bandeira do misticismo, que não deriva do desejo de conseguir o divino, e sim de um medo da Sorte que os deuses – em seus conclaves secretos ou códigos ocultos – reservaram para a Humanidade. Uma parte dessa sabedoria foi ou pôde ser revelada aos homens quando a Sabedoria e o Entendimento foram recuperados pelo desafio de Deus a Jó em relação ao que ele não sabia (mas Deus sabia). “Diz se tiveres ciência”, disse o Senhor a Jó, que sofria:

“Quem mediu a Terra, que se saiba? Quem esticou uma corda sobre ela? Em que plataforma foi erguida? Quem lançou a pedra fundamental? De onde veio a Sabedoria? Qual o lugar da Inteligência? Escondida está aos olhos de todos os seres viventes. Deus entende os caminhos, Ele mesmo conhece o lugar. Porque vê as extremidades do mundo, vê tudo debaixo do céu”.

Com tais palavras, o “Senhor” da Bíblia desafia Jó (no capítulo 28) para que pare de questionar sobre sua Sorte ou sobre o propósito principal; pois o conhecimento do homem – Sabedoria e Entendimento – fica tão longe do divino que não serve a nenhum propósito questionar ou tentar adivinhar os desígnios de Deus. Esse tratamento antigo de Sabedoria e Inteligência (Entendimento) dos segredos do céu e da Terra – da ciência -, como domínio divino ao qual poucos humanos possuem acesso, encontrou expressão não apenas nos escritos canônicos, mas também no misticismo judeu, nos ensinamentos da Cabala. De acordo com eles, a Presença Divina, simbolizada pela Coroa de Deus, apóia-se nos dois penúltimos estágios, denominados Sabedoria (Hochma) e Entendimento (Binah). São os mesmos componentes da sabedoria científica em relação à qual Jó foi desafiado. As referências à Hochma (Sabedoria) no Velho Testamento revelam que foi considerada um presente divino, porque o Senhor do Universo era o dono da Sabedoria necessária para criar o céu e a Terra. “Como são grandes Teus feitos, ó Senhor; com sabedoria os atastes”, afirma o Salmo 104 enquanto descreve e louva, passo a passo, o trabalho do Criador.

Quando o Senhor garante a Sabedoria a alguns humanos, afirma a Bíblia, ele na verdade compartilha com eles sabedoria secreta em relação aos céus e à Terra, e a tudo o que está sobre a Terra. O Livro de Jó descreve tal sabedoria como “Segredos de Sabedoria” que não lhe tinham sido revelados. Revelação, a partilha de sabedoria secreta com a humanidade por intermédio de “iniciados” escolhidos, começou antes do Dilúvio. Adapa, o filho de Enki a quem Sabedoria e Entendimento (mas não Vida Eterna) foram garantidos, conheceu por intermédio de Anu a extensão do céu, não como mera viagem excitante. Referências pós-diluvianas a ele lhe atribuíam a autoria de um trabalho conhecido como Escritos Relativos ao Tempo, Divino Anu e Divino Enlil – um tratado que lida com a passagem do tempo e o calendário. A História de Adapa, por outro lado, menciona especificamente que ele aprendeu, em Eridu, as artes da medicina e da cura. Assim, foi um cientista equilibrado, entendido tanto em assuntos celestes quanto terrestres: foi também ungido como o Sacerdote de Eridu – talvez o primeiro a combinar Ciência e Religião.

Os antigos registros sumérios falam de outro Escolhido antediluviano, que foi iniciado nos segredos divinos ao ser levado à habitação divina dos anunnaki. Veio de Sippar (“Cidade dos Pássaros”), onde Utu/Shamash governava, e provavelmente era filho dele, um semideus. Conhecido nos textos como EN.ME.DUR.ANNA ou EN.MEDUR.AN.KI (“Mestre dos Divinos Tabletes que Falam do Céu” ou “Mestre dos Divinos Tabletes da Ligação Céu-Terra”), ele também foi receber sabedoria secreta fora da Terra. Seus patrocinadores e professores foram os deuses Utu/Shamash e Ishkur/ Adad. 

“Shamash e Adad o (vestiram? Ungiram?), Shamash e Adad o colocaram num grande trono de ouro. Mostraram a ele como observar óleo e água, um segredo de Anu, Enlil e Ea. Deram-lhe um tablete divino, o Kibbu, um segredo do Céu e da Terra. Colocaram em sua mão um instrumento de cedro, favorito entre os grandes deuses. Ensinaram-no a fazer cálculos com números”.

Embora a História de Adapa não diga explicitamente, parece que lhe permitiram, senão exigiram, que partilhasse um pouco sua sabedoria secreta com seus companheiros humanos; por que outro motivo ele escreveria o renomado livro? No caso de Enmeduranki, a transmissão dos segredos aprendidos também foi ordenada porém com a restrição que se limitasse à linhagem dos sacerdotes, de pai para filho, começando com Enmeduranki:

“O sábio que aprendeu e guarda os segredos dos grandes deuses comprometerá seu próprio filho com um juramento perante Shamash e Adad. Pelo Tablete Divino, com um estilete, irá instruí-lo nos segredos dos deuses”.

O tablete no qual esse texto foi inscrito (atualmente guardado no Museu Britânico) possui um pós-escrito:

“Assim foi criada a linhagem de sacerdotes, aqueles que podem aproximar-se de Shamash e Adad”.

A Bíblia também guardou a ascensão do patriarca antediluviano Enoch – o sétimo dos dez listados, assim como Enmeduranki na lista de reis sumérios. Dessa extraordinária experiência, a Bíblia apenas aponta que, com a idade de 365 anos, Enoch foi levado para estar com Deus. Felizmente o apócrifo Livro de Enoch, passado ao longo dos milênios e sobrevivendo em duas versões, providenciou muito mais detalhes; quanto é originalmente antigo e quanto era especulação quando os livros foram compilados, no início da Era Cristã, não se pode dizer. Mas o conteúdo vale a pena ser sumariado, mesmo que não seja por outro motivo que a história de Enmeduranki, e por causa de uma narrativa breve em outro livro extrabíblico, o Livro dos Jubileus. Dessas fontes emerge o fato de que Enoch não fez uma, mas duas jornadas celestiais. Na primeira vez em que ele aprendeu os Segredos do Céu, foi instruído para transmitir a sabedoria aos seus filhos em seu retorno à Terra.

Ao ascender em direção à Habitação Divina, foi levado através de uma série de esferas celestiais. Do lugar no Sétimo Céu ele podia enxergar a forma dos planetas; no Oitavo Céu ele conseguia discernir as constelações. O Nono Céu era a “Casa dos Doze Signos do Zodíaco”, e o Décimo Céu era o Divino Trono de Deus. (Deve ser notado aqui que a habitação de Anu, segundo os textos sumérios, era em Nibiru, que já identificamos como planeta de nosso Sistema Solar. Na crença da Cabala, o caminho para a habitação de Deus passa através de dez sefirot, traduzidos como “brilhos”, porém na verdade representados como dez esferas concêntricas, sendo a central denominada Yessod (“Fundação”), a oitava e a nona, Binah e Hochma (“Entendimento e Sabedoria”), e a décima e mais elevada, Ketter, a Coroa do Altíssimo. Além disso estende-se Ein Soff (“o Infinito”).

Acompanhado de “dois anjos”, Enoch finalmente chegou a seu destino final, a Habitação de Deus. Suas vestes terrestres foram removidas; ele foi vestido com roupas divinas e ungido pelos anjos (como foi feito com Adapa). Por ordem do Senhor, o arcanjo Pravuel ditou os “livros do armazém divino” e deu a Enoch um estilete para que anotasse o que seria ditado. Por trinta dias e trinta noites Pravuel ditou e Enoch escreveu

“Os segredos dos trabalhos dos céus, da Terra e dos mares; e de todos os elementos, suas idas e vindas e o trovejar dos trovões; e [os segredos] do Sol e da Lua, e as mudanças dos planetas; as estações do ano e os anos, dias e horas… e todas as coisas dos homens, as línguas de cada canção humana… e todas as coisas que vale a pena aprender”.

Segundo o Livro de Enoch, toda essa vasta sabedoria, “segredos de Anjos e Deus”, foi anotada em 360 livros sagrados, quando Enoch os levou de volta à Terra. Enoch chamou seus filhos, mostrou-lhes os livros e explicou o conteúdo a eles. Ainda falava e ensinava quando sobreveio uma grande escuridão e o devolveu aos céus; eram precisamente o dia e hora de seu 365º. aniversário. A Bíblia (Gênesis 5:23-24) afirma simplesmente: “E todos os dias de Enoch foram 365; e Enoch caminhou com Deus (El), e cessou de ser, pois foi levado pelos Elohim (deuses)”.

Uma importante similaridade entre as três histórias (Adapa, Enmduranki e Enoch) é o envolvimento de dois seres divinos na experiência celestial. Adapa foi recepcionado no Portão de Anu, e acompanhado para entrar e para sair pelos dois jovens deuses Dumuzi e Gizida; os professores/patronos de Enmeduranki foram Shamash e Adad; Enoch foi levado por dois arcanjos. As histórias sem dúvida foram inspiração para uma representação assíria do portão celestial, guardado por dois homens-águia. O portão ostenta o símbolo de Nibiru; o disco alado e a localização celestial são indicados pelos símbolos celestiais da Terra (como sétimo planeta), a Lua e o Sistema Solar completo.

Outro aspecto que chama a atenção – embora não explicitamente no caso de Enoch – é a tradição de que a cessão da Sabedoria e do Entendimento tornava o indivíduo escolhido não apenas um cientista, mas também um sacerdote, e, além disso, progenitor de uma linhagem sacerdotal. Encontramos esse princípio representado no deserto do Sinai durante o Êxodo, quando Yahweh, o Deus bíblico, escolhe Aarão (irmão de Moisés) e seus filhos para serem sacerdotes (Êxodo 28:1). Já diferenciados por pertencer à tribo de Levi, tanto por parte de pai como de mãe (Êxodo 2:1), Moisés e Aarão foram iniciados em poderes mágicos que os capacitaram a realizar milagres, assim como a deflagrar as calamidades destinadas a convencer o faraó de que o povo israelita devia partir do Egito. Aarão e seus filhos foram então santificados – “elevados”, segundo nosso vocabulário atual – e se tornaram sacerdotes dotados de um lastro respeitável de Sabedoria e Entendimento.

O Levítico lança uma luz em uma parte da sabedoria que foi transmitida para Aarão e seus filhos. Incluía segredos do calendário (bastante complexo, já que era um calendário lunar-solar), de doenças e curas, tanto de humanos como de animais. Uma quantidade considerável de informações anatômicas é incluída nos capítulos relevantes do Levítico, e a possibilidade de que os sacerdotes hebreus recebessem aulas “à parte” não pode ser deixada de lado em vista de que modelos de partes anatômicas feitos em cerâmica, com instruções médicas gravadas, eram comuns na Babilônia mesmo antes da época do Êxodo. {A Bíblia descreve o rei Salomão como o mais “sábio dos homens”, que podia falar sobre a biodiversidade de todas as plantas, “desde os cedros do Líbano até o hissopo que cresce numa parede, de animais, pássaros, coisas rastejantes e peixes”. Podia fazer isso porque além de Sabedoria e Entendimento, dados por Deus, ele adquirira Da’ath – o equilíbrio (no USO) do conhecimento aprendido.}

A linhagem sacerdotal se iniciou com Aarão, que se sujeitou a várias leis impondo restrições matrimoniais e de procriação. Com quem eles podiam ter relações conjugais e, sobretudo, com quem poderiam casar para que “a semente sacerdotal não fosse profanada”; e se a semente de alguém fosse imperfeita – “tivesse uma imperfeição”, uma mutação, um defeito genético -, então aquele homem estava proibido, por todas as gerações, de realizar deveres sacerdotais, “pois eu, Yahweh, santifiquei a linhagem sacerdotal” de Aarão. Tais restrições intrigaram centenas de estudiosos da Bíblia; porém o verdadeiro significado tornou-se evidente com o advento das pesquisas sobre DNA. Foi apenas em janeiro de 1997, na revista Nature, que um grupo internacional de cientistas anunciou a existência de um “Gene Sacerdotal” entre os judeus, cuja linhagem podia ser seguida até Aarão. A tradição judaica requer até hoje que no Sabat e nos Dias Santos os serviços devam ser realizados por um Cohen.

Este termo, que significa “sacerdote”, foi usado pela primeira vez na Bíblia para descrever Aarão e seus filhos. Desde então, a designação tem passado de pais para filhos ao longo das gerações, e a única forma de ser um Cohen é nascer de um pai Cohen. Esse status privilegiado tem sido confundido pelo uso de Cohen como sobrenome (alterado também para Kahn, Kahane, Kuhn) ou como adjetivo acrescentado ao nome, ou como título: Ha-Cohen, “O sacerdote”. Foi esse aspecto da natureza patriarcal da tradição Cohen dos judeus que intrigou um grupo de pesquisadores de Israel, da Inglaterra, do Canadá e dos Estados Unidos. Focalizando-se no cromossomo Y, passado de pai para filho, testaram centenas de “Cohens” em vários países e descobriram a existência óbvia de dois marcadores únicos no cromossomo. Isso provou ser verdadeiro tanto para os asquenazes (Khazares – do Leste europeu) quanto para os sefarditas (Oriente Médio/ África), judeus que se espalharam depois da destruição do Templo pelos romanos em 70 d.C. indicando a antiguidade dos marcadores genéticos. “A explicação mais simples e direta é que esses homens possuem o cromossomo Y de Aarão”, afirma o Dr. Karl Skorecki, do Instituto Israelita de Tecnologia, em Haifa [Israel].

As histórias daqueles que foram iniciados na sabedoria secreta testemunham que a informação foi escrita em “livros”. Estes, na certa, não eram o que atualmente chamamos de “livros” – páginas escritas e presas juntas. Os muitos textos descobertos nas cavernas próximas ao mar Morto, em Israel, são chamados de Manuscritos do Mar Morto, pois eram textos inscritos em folhas de pergaminho (em sua maior parte elaborados em couro de cabra) costurados juntos para formar rolos, na forma em que os Rolos da Lei (os cinco primeiros livros da Bíblia Hebraica) são feitos e enrolados até hoje. Os profetas bíblicos (especialmente Ezequiel) mencionavam rolos como parte das mensagens divinas recebidas. Os antigos textos egípcios eram elaborados em papiros – folhas feitas de plantas aquáticas que crescem à beira do Nilo; e os textos mais antigos que se conhecem foram inscritos em tabletes de argila; usando um estilete de junco ou bambu, o escriba fazia marcas numa argila ainda molhada, que, depois de seca, tornava o tablete um documento.

Em que forma teriam sido os “livros” escritos por Adapa, Enmeduranki e Enoch (este último com 360 deles!)? Levando em conta que teriam sido elaborados antes do Dilúvio – milhares de anos antes da civilização suméria -, provavelmente em nenhuma das formas pós-diluvianas – embora o rei assírio Assurbanipal se jactasse de poder ler “escrita de antes da Enchente”. Desde que a cada instância o que se escreveu foi ditado pelo Senhor divino, seria lógico imaginar que a escrita teria sido no que alguns textos sumérios e acadianos chamam de Kitab Ilani – “escrita dos deuses”. Referências a tais escritos feitos pelos anunnaki podem ser encontradas, por exemplo, em inscrições que lidam com a reconstrução de templos caídos, nas quais é afirmado que a reconstrução fora baseada em desenhos dos tempos antigos e na escrita do “Céu Superior”. Os sumérios mencionavam uma deusa, Nisaba (algumas vezes chamada Nidaba), como protetora dos escribas e dos que mantinham os registros para os deuses; seu símbolo era o Estilete Sagrado.

Uma das referências aos escritos dos deuses na época primitiva é encontrada num texto hitita duplicado por estudiosos, chamado A Música de Ullikummis. Escrito em tabletes de cera descobertos na antiga capital hitita de Hattusa (perto da atual aldeia de Boghaskoy, na Turquia central), relata a história intrigante de um “vigoroso deus feito de minério de diorito” que um antigo deus, a quem os hititas chamavam de Kumarbis, inventara para desafiar outros deuses. Os deuses desafiados, incapazes de enfrentar ou suplantar o desafiante Ullikummis, apresentavam-se na habitação de Enki, no Mundo Inferior, para obter dele os “antigos tabletes com as palavras da sorte”. Porém quando o “antigo depósito” foi aberto, e depois foram removidos os “selos de antanho” com os quais os tabletes foram lacrados, descobriu-se que os escritos tinham sido redigidos na “escrita antiga”, sendo necessários os Velhos Deuses para interpretá-los. No Egito, era Thoth o venerado como o Escriba Divino. Foi ele quem, depois do Conselho dos Deuses, resolveu reconhecer Hórus como herdeiro legítimo, inscreveu num tablete de metal o Decreto dos Deuses, e o tablete então foi colocado na “Divina Câmara das Gravações”.

Além das gravações para uso divino, os egípcios também acreditavam que Thoth escrevia livros para instruir os mortais. O Livro dos Mortos, afirmavam eles, era uma composição escrita por Thoth “com os próprios dedos”. E nas Histórias dos Mágicos, ao qual já nos referimos anteriormente, era contado que o vivo mas inanimado rei e a rainha a quem Thoth punira guardavam, na câmara subterrânea, “o livro que o deus Thoth escrevera com a própria mão” e no qual revelava a sabedoria secreta referente ao Sistema Solar, à astronomia e ao calendário. Quando quem buscava tais conhecimentos penetrava na câmara subterrânea, via o livro “emitindo uma luz forte como se o Sol brilhasse ali no interior”. O que eram esses “livros divinos” e que tipo de escrita se podia encontrar neles?

O nome-epíteto de Enmeduranna, “Mestre dos Divinos Tabletes Concernentes ao Céu”, chama atenção para o termo ME no nome, traduzido aqui como “Tabletes Divinos”. Na verdade, ninguém sabia o que eram esses tabletes, se eram verdadeiros tabletes ou algo mais parecido com chips de memória de computador ou com disquetes. Eram objetos pequenos o suficiente para serem segurados com uma mão, pois foi dito que Inana/Ishtar, procurando elevar sua cidade Uruk até o status de capital, obteve de forma ardilosa de Enki trechos de ME que estavam codificados com segredos de Supremo Domínio, Realeza, Sacerdócio e outros aspectos de uma civilização avançada. E lembramos que o maldoso Zu roubou de Duranki os Tabletes dos Destinos e os ME que estavam codificados com as Fórmulas Divinas. Talvez possamos entender o que queriam se examinarmos a tecnologia alguns milênios à frente.

Colocando de lado a questão dos próprios escritos do deus e a conservação dos dados para propósitos próprios, a questão sobre que linguagem e que sistema de escrita estavam usando na ocasião em que a sabedoria secreta foi ditada aos habitantes da Terra se torna de grande significado quando chegamos à Bíblia – e sobretudo em relação aos eventos no monte Sinai. Em paralelo à história de Enoch, que permaneceu em sua habitação celestial “trinta dias e trinta noites” recebendo um ditado, foi o relato bíblico de Moisés, que, tendo subido em direção ao “Senhor” Deus no topo do monte Sinai, “ficou com Yahweh quarenta dias e quarenta noites – “pão não foi consumido e água não foi bebida”, enquanto escrevia nas tábuas as palavras do Pacto de Aliança e dos Dez Mandamentos que Deus ditava (Êxodo 34:28). Aqueles, na verdade, foram o segundo conjunto de tabletes, substituindo o primeiro que Moisés atirara, num acesso de ira, quando descera do monte Sinai numa ocasião anterior. A Bíblia fornece intrigantes detalhes com relação à primeira apresentação dos textos sagrados; naquela oportunidade, afirma a Bíblia explicitamente, Deus “em pessoa” fez as inscrições!

A história começa no capítulo 24 do livro do Êxodo, quando Moisés, Aarão e dois de seus filhos, além de setenta dos Anciãos de Israel, foram convidados para aproximar-se do pico do monte Sinai, onde o “Senhor” aterrissara em sua Kabod. Lá, os dignitários perceberam a presença divina como uma densa nuvem, cegante como um “fogo devorador”. Depois Moisés sozinho foi chamado ao topo para receber a Torá (“Os Ensinamentos”) e os Mandamentos que o Senhor Deus já escrevera:

“E Yahweh disse a Moisés: Sobe ao alto do monte onde estou e fica aí, e te darei umas tábuas de pedra – a Lei e os Mandamentos – que eu escrevi, para que instruas neles o povo”. Êxodo 24: 12 “E Moisés entrou no meio da nuvem e escalou o monte; ficou lá quarenta dias e quarenta noites.” Depois: Tendo Yahweh acabado de falar dessa forma no monte Sinai, deu a Moisés as duas Tábuas do Testemunho – feitas de pedra, e escritas pelo dedo dos Elohim (deuses). Êxodo 31:17

Informações surpreendentes em relação às Tábuas e à maneira como foram escritas aparecem em Êxodo 32:16-17, descrevendo os eventos que aconteceram enquanto Moisés descia do monte, depois de uma longa e (para o povo) inexplicável ausência:

“Regressou Moisés pois do topo do monte, trazendo em sua mão as duas Tábuas do Testemunho – inscritas em ambos os lados, inscritas de um dos lados e do outro lado. E as Tábuas eram obras de Deus, E as tábuas eram o trabalho de Elohim (deuses), como o era a escritura, assim como era a caligrafia de Elohim (deuses) que estava gravada nelas”. Êxodo 32:15

O “Bezerro de Ouro” hoje esta situado em Wall Street, sede financeira dos EUA, controlada pelos judeus Khazares …

Duas tábuas feitas de pedra, divinamente trabalhadas. Inscritas na frente e no verso na “escrita de Elohim” – o que deve significar tanto linguagem como escrita; e gravada na pedra pelo próprio Deus! E tudo numa linguagem e num contexto em que Moisés podia ler e entender, já que precisava ensinar a todos os hebreus… Como sabemos pelo restante do relato bíblico, Moisés arrebentou as duas tábuas quando, alcançando o acampamento, viu que em sua ausência o povo hebreu construíra um bezerro (ÍDOLO) de ouro para ser adorado segundo os costumes egípcios. Quando a crise terminou:  Depois disse Yahweh a Moisés: Corta duas tábuas de pedra, que sejam iguais às primeiras, e eu escreverei nelas as palavras que estavam nas tábuas que tu quebraste. Êxodo 34:1

E assim fez Moisés, e subiu ao monte outra vez. Lá, Yahweh veio na direção dele, e Moisés se curvou e repetiu os pedidos para que desculpasse o povo. Em resposta, o Senhor Deus ditou a ele mandamentos adicionais, dizendo:

“Escreve estas palavras, porque de acordo com elas fiz uma Aliança contigo e com o povo de Israel”. E Moisés ficou no monte quarenta dias e quarenta noites, gravando nas tábuas “as palavras da Aliança e os Dez Mandamentos” (Êxodo 35:27-28).

Dessa vez, Moisés estava escrevendo o que lhe era ditado. Não apenas as seções do Êxodo, Levítico e Deuteronômio gravavam os Ensinamentos e Mandamentos; mas todos os cinco primeiros livros da Torá (os já citados mais Gênesis e Números) tiveram a intenção, desde o início, de ser escritos sagrados. Reunidos sob o termo geral Torá, também são conhecidos como Os Cinco Livros de Moisés, por causa da tradição que o próprio Moisés escreveu ou foi autor dos cinco como revelações divinas a ele. Portanto os rolos da Torá que são retirados de suas arcas durante os Sabat e Dias Santos devem ser copiados (por escribas especiais) precisamente da forma que foram revelados ao longo das eras – livro a livro, capítulo a capítulo, versículo a versículo, palavra a palavra, letra a letra. Um erro de uma letra invalida o rolo inteiro. Embora essa precisão letra a letra tenha sido estudada pelos sábios judeus e estudiosos bíblicos ao longo do tempo (muito antes do recente interesse pelos “códigos secretos” da Torá), existe um aspecto desafiador do ditado longo e da precisão letra a letra que tem sido completamente ignorado: Tal método de escrita do monte Sinai não poderia ter sido a lenta escrita cuneiforme da Mesopotâmia, geralmente gravada com um estilete em argila molhada, nem o método hieroglífico pictórico para monumentos utilizado no Egito Antigo. O volume da escrita e a precisão letra a letra exigiam uma escrita alfabética! O problema é que na época do Êxodo, por volta de 1450 a.C. a escrita alfabética não existia em nenhum lugar no mundo antigo. 

O conceito de alfabeto é um trabalho de gênio; quem quer que tenha sido esse gênio, ele baseou-se em conhecimentos existentes. A escrita hieroglífica do Egito avançou de sinais pictográficos, que mostravam objetos, para sinais que representavam sílabas ou mesmo consoantes; porém permanecia um sistema complexo de inumeráveis sinais pictográficos. Os sumérios avançaram de seus primeiros sinais pictográficos para cuneiformes, e esses sinais adquiriram um som silábico; mas, para formar com eles um vocabulário, eram necessárias centenas de sinais diferentes. O gênio que combinou a facilidade cuneiforme com os avanços egípcios para consoantes conseguiu fazer isso com apenas 22 sinais! Começando com aquilo, o engenhoso inventor perguntou a si mesmo, bem como a seu discípulo: qual a palavra para o que você vê? A resposta, na linguagem dos israelitas semíticos, foi Aluf. Muito bem, disse o inventor, vamos chamar esse símbolo de Aleph e pronunciar simplesmente “A”. Em seguida, desenhou o pictograma para casa. Como chama a este? Perguntou ele, e o discípulo respondeu: Bayit. Muito bem, respondeu o inventor, daqui para a frente vamos chamar esse sinal de “Beth” e pronunciar simplesmente como “B”.

Não podemos jurar que uma conversa assim tenha realmente acontecido, mas estamos certos de que foi esse o processo de criação e invenção do alfabeto. A terceira letra, Gimel (pronunciado “G”), era a imagem de um camelo (Gamal em hebraico); a seguinte, Daleth, que é o “D”, representando Deleth, “porta” (em seus gonzos), e assim por diante por meio das 22 letras do alfabeto semítico, todas servindo de consoantes e três delas que podiam dobrar funções como vogais. Quem foi esse gênio inovador? Se formos aceitar a opinião corrente, terá sido algum trabalhador braçal, um escravo em alguma mina egípcia de turquesas no Sinai ocidental, próxima do mar Vermelho, porque foi ali que sir Flinders Petrie encontrou, em 1905, sinais desenhados nas paredes, que uma década mais tarde sir Alan Gardiner decifrou como “acrofônicas” (Relativas à acrofonia, sistema gráfico antigo, evolução da escrita hieroglífica, que consistia em atribuir ao desenho ou ao ideograma de um objeto o valor fonético da letra ou da sílaba inicial do nome desse objeto) – soletrando L-B-A-L-T; significava dedicado “à Senhora” (presumivelmente a deusa Hátor) – porém em semítico, não em egípcio!

Escritos posteriores descobertos na área não deixaram dúvidas de que o alfabeto se originou lá; de lá, espalhou-se por Canaã e depois para a Fenícia (onde uma tentativa de expressar a engenhosa idéia com sinais cuneiformes não durou muito). Executada com maestria, a “escrita do Sinai” serviu como escrita do Templo de Jerusalém e como escrita real dos reis judeus, até ser substituída, durante a época do Segundo Templo, por uma escrita quadrada emprestada dos aramaicos (a escrita usada nos Manuscritos do Mar Morto até os tempos modernos). Ninguém ficou confortável com a atribuição da revolucionária inovação, no final da Idade do Bronze, a um escravo em minas de turquesa. Seria necessário um conhecimento extraordinário de fala, escrita e lingüística, sem mencionar a Sabedoria e o Entendimento, que dificilmente poderiam ser reunidas num simples escravo. E qual seria o propósito de inventar uma nova escrita quando, nas mesmas áreas de mineração, monumentos e paredes estavam repletos de inscrições hieroglíficas egípcias? Como podia uma inovação obscura numa área restrita a Canaã e pouco além substituir um método de escrita que vinha servindo bem havia dois milênios? Simplesmente não fazia sentido; porém na ausência de outra solução, essa teoria ainda resiste. Mas, se imaginamos direito a conversa que conduziu a esse alfabeto, então teria sido Moisés a receber a primeira lição. Ele se encontrava no Sinai; estava lá na época certa; empenhou-se em escrever longamente; e teve o professor supremo – o próprio Deus.

Pouca atenção recebeu nas narrativas bíblicas o fato de que Moisés foi instruído por Yahweh a escrever as coisas mesmo antes de subir ao monte Sinai para receber as Tábuas. A primeira vez foi antes da guerra com os amalecitas, uma tribo que, em vez de agir como aliada, traiu os hebreus e os atacou. Aquela traição, afirmou Deus, devia ser lembrada por todas as gerações futuras: “E Yahweh disse a Moisés: Escreve isso num livro para servir de lembrança” (Êxodo 17:14). A segunda menção de um livro para lembrar-se ocorre em Êxodo 24:4 e 24:7, em que se afirma que o Senhor Deus, falando numa voz retumbante do alto do monte, enumerou as condições para uma Aliança eterna entre Ele e os Filhos de Israel: “Escreveu Moisés todas as palavras de Yahweh, e erigiu um altar no sopé do monte e doze pilares de pedra, conforme era o número das tribos de Israel”. E, então, “ele pegou o livro no qual estava registrada a aliança e leu-o para o povo ouvir”. O ditado e as anotações, portanto, iniciaram-se antes que Moisés subisse ao alto da montanha para obter as tábuas escritas por duas vezes.

É preciso examinar os primeiros capítulos do Êxodo para descobrir quando (e como foram as primeiras inovações alfabéticas) – a linguagem e os escritos empregados na comunicação entre o Senhor e Moisés – podiam ter ocorrido. Lá, ficamos sabendo que Moisés, adotado como filho pela filha do faraó, fugiu para salvar sua vida quando matou um oficial egípcio. Seu destino foi a península do Sinai, onde terminou se relacionando com o sumo sacerdote midianita (e casando com sua filha). E um dia, pastoreando, penetrou no deserto onde ficava o “monte dos Elohim” (deuses) e lá ele foi  chamado por Deus, de uma sarça ardente, e recebeu a tarefa de liderar seu povo, os Filhos de Israel, para fora do Egito. Moisés retornou ao Egito apenas depois da morte do faraó que o havia sentenciado (Tutmés III, pelos nossos cálculos), em 1450 a.C. e lutou com o faraó seguinte (Amenófis II, em nossa opinião) por sete anos até que o Êxodo fosse permitido.

Tendo começado a ouvir sobre o Senhor Deus ainda no deserto, depois durante os sete anos, teve bastante tempo para inovar e dominar uma nova forma de escrita, uma que fosse mais simples e muito mais rápida do que a dos grandes impérios daquela época mesopotâmico, egípcio e hitita. A Bíblia relata extensivas comunicações entre Yahweh, Moisés e Aarão desde o momento em que Moisés foi chamado para o arbusto flamejante. Se as mensagens divinas, às vezes envolvendo informações detalhadas, foram escritas ou não escritas, a Bíblia não afirma; parece significativo, porém, que os mágicos da corte do faraó acreditavam ser instruções escritas:

“Então disseram os mágicos ao faraó: o dedo de Deus é o que obra aqui” (Êxodo 8:19).

Lembramos que “O dedo de Deus era o termo usado no Egito para referir-se ao deus Thoth, para indicar uma escrita pelo próprio Deus”. Se tudo isso leva à sugestão de que a escrita alfabética começou na península do Sinai – não deveria ser surpreendente que os arqueólogos tenham chegado à mesma conclusão, porém sem ter como explicar tal inovação tremenda e ingênua surgindo no meio do deserto. Será que a conversa que imaginamos realmente se realizou, ou Moisés inventou o alfabeto por si mesmo? Afinal de contas, ele estava na península do Sinai naquela época, possuía a educação primorosa da corte do Egito (onde a correspondência com a Mesopotâmia e os hititas continuava) e sem dúvida aprendera a linguagem semita dos midianitas (se já não a conhecia por parte dos israelitas no Egito). Será que ele, nas perambulações pela península do Sinai, encontrou escravos semitas (israelitas escravizados pelos egípcios) esboçarem rudemente nas paredes das minas sua idéia de uma nova forma de escrita?

Seria bom atribuir a brilhante inovação a Moisés agindo sozinho; seria gratificante creditar ao líder bíblico do Êxodo, o único que conversara pessoalmente com Deus, segundo a Bíblia, a invenção do alfabeto e a revolução cultural deflagrada. Porém as repetidas referências à Escrita Divina, o próprio Deus escrevendo e Moisés apenas anotando, sugerem que a escrita alfabética e o sistema de linguagem falada e escrita eram um dos “segredos dos deuses”. Sem dúvida, era o mesmo Yahweh ao qual a Bíblia atribuía a invenção/inovação de outras linguagens e escritas numa ocasião anterior – logo depois do episódio da Torre de Babel.

De uma forma ou de outra, sentimos que Moisés era o iniciado por meio do qual a inovação foi revelada à Humanidade. Assim podemos chamar de Alfabeto Mosaico.  Existe mais ainda sobre o primeiro alfabeto do que um mero “segredo dos deuses”. Em nossa opinião, é baseado numa tecnologia mais sofisticada e importante – aquela do código genético.  Quando os gregos adotaram o alfabeto mosaico, mil anos depois (embora revertendo-o numa imagem espelhada), acharam necessário adicionar mais letras para cobrir todas as necessidades de pronúncia. Na verdade, dentro dos limites das 22 letras do alfabeto mosaico-semita, algumas letras são pronunciadas de forma “suave” (V, Kh, S, Th) ou “forte” (B, K, SH, T); e outras letras ainda dobram como vogais. Na verdade, se contemplarmos esse número 22 – nem mais nem menos -, não podemos evitar de nos lembrar da restrição aplicada ao número sagrado 12 (requerendo a adição ou abandono de divindades a fim de manter o “Círculo Olímpico” em precisamente doze).

Tal princípio oculto – divinamente inspirado – se aplica à redução do alfabeto original para 22 letras? O número devia ser familiar naquela época. É o mesmo número de cromossomos (vinte e dois) humanos quando O Adão foi criado, antes da segunda manipulação genética, que adicionou os cromos somos sexuais “Y” e “X” (quando Adão passou a ter condições de se reproduzir)! Teria o Todo-Poderoso revelado a Moisés o segredo do alfabeto, usando o código genético como código secreto do alfabeto?  A resposta parece ser afirmativa. Se essa conclusão se afigura estranha, vamos examinar a afirmação do Senhor em Isaías 45:11:

“Fui eu quem criou as letras… Eu é que fiz a Terra e quem sobre ela criei o Homem”, assim falou Yahweh, o Santo de Israel.

Quem quer que estivesse envolvido na criação do Homem estava envolvido na criação das letras que formavam o alfabeto. Os sistemas atuais de computadores (código binário) para construir palavras e números a partir de apenas duas “letras”, um sistema Sim-Não de zeros e uns combinando-se com um fluxo liga-desliga de elétrons (por isso chamado binário). Mas a atenção já se transferiu para o código genético de quatro letras e para a velocidade muito maior com a qual as mudanças se efetuam no interior da célula viva. Conceitualmente, a atual linguagem de computadores, expressa numa seqüência do tipo 0100110011110011000010100 etc. (e em incontáveis variações usando “O” e “I”), pode ser encarada como a linguagem genética de um fragmento de DNA, expressa como uma seqüência de nucleotídeos CGTAGAATTCTGCGAACCTT, e assim por diante numa corrente de ligações de letras do DNA (são sempre agrupadas em “palavras” de três letras) – A se liga com T, C liga-se com G.

O problema e o desafio é como criar e ler chips de computador recobertos não por “0” e “1”, mas por partículas de material genético. Avanços desde 1991 em várias instituições acadêmicas, assim como em empresas comerciais envolvidas em tratamento genético, tiveram sucesso em criar chips de silício recoberto com nucleotídeos. Ao avaliar a velocidade e as capacidades do computador de DNA, afirma uma pesquisa publicada em Science (outubro de 1997): “A capacidade de armazenamento de informação do DNA é enorme”. Na natureza, a informação genética codificada no DNA é decodificada, à velocidade da luz, por um mensageiro chamado RNA, que transcreve e combina as “letras” do DNA em “palavras” de três letras. Já foi estabelecido que esses agrupamentos de três letras encontram-se no cerne de toda a vida na Terra, porque soletram química e biologicamente os vinte e dois aminoácidos cujas cadeias formam as proteínas das quais toda a vida na Terra – e provavelmente em todos os outros lugares do cosmos – se forma.

O hebraico, uma linguagem rica e precisa, é baseado em “palavras-raízes”, das quais derivam verbos, substantivos, advérbios, adjetivos, pronomes, tempos verbais, conjugações e todas as formas gramaticais. Por motivos que ninguém sabe explicar, essas “palavras-raízes” são constituídas de três letras. Essa é uma diferenciação do acadiano, a língua-mãe de todas as línguas semitas, que são formadas por sílabas – algumas vezes apenas uma, e em outras, duas, três ou mais.  O motivo para as palavras-raízes de três letras no hebraico poderia ser a linguagem de três letras no DNA – a fonte, conforme concluímos, do próprio alfabeto? Se assim for, então as palavras raízes de três letras corroboram essa conclusão.

“A vida e a morte estão na linguagem”(no PODER do VERBO), afirma a Bíblia em Provérbios (18:21). Essa afirmação tem sido tratada alegoricamente. Talvez seja hora de encará-la literalmente: a linguagem da Bíblia Hebraica e do código genético do DNA da vida (e da morte) não seria senão dois lados da mesma moeda. Os mistérios codificados nesse interior são mais vastos do que se pode imaginar; incluem, entre outras descobertas maravilhosas, os segredos da cura.


Matrix (o SISTEMA de CONTROLE):  “A Matrix é um sistema de controle, NEO. Esse sistema é o nosso inimigo. Mas quando você está dentro dele, olha em volta, e o que você vê? Empresários, professores, advogados, políticos, carpinteiros, sacerdotes, homens e mulheres… As mesmas mentes das pessoas que estamos tentando despertar. 

Mas até que nós consigamos despertá-los, essas pessoas ainda serão parte desse sistema de controle e isso as transformam em nossos inimigos. Você precisa entender, a maioria dessas pessoas não está preparada para ser desconectada da Matrix de Controle. E muitos deles estão tão habituados, tão profunda e desesperadamente dependentes do sistema, que eles vão lutar contra você  para proteger o próprio sistema de controle que aprisiona suas mentes …” 


Para saber mais, leitura adicional: 


Permitida a reprodução desde que mantida a formatação original e a citação das fontes.

thoth(172x226)www.thoth3126.com.br

One Response to O Código Cósmico – 7 – Sabedoria Secreta, Textos Sagrados

  1. Elsa Cristina Ferreira Pacheco

    Li todo este artigo, e gostei, fez imensa ressonância. Contudo pergunto, se a escrita era diferente e talvez até escassa, como pensávamos, que palavras usavamos para pensar… 🙄 Fica estranho assim

Deixe uma resposta

O seu endereço de e-mail não será publicado. Campos obrigatórios são marcados com *

Esse site utiliza o Akismet para reduzir spam. Aprenda como seus dados de comentários são processados.